Review



puromycin resistance gene 22 rd114a glycoprotein coding sequences  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc puromycin resistance gene 22 rd114a glycoprotein coding sequences
    Puromycin Resistance Gene 22 Rd114a Glycoprotein Coding Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/puromycin+sequence/pm41481387-44-13-26?v=Addgene+inc
    Average 94 stars, based on 19 article reviews
    puromycin resistance gene 22 rd114a glycoprotein coding sequences - by Bioz Stars, 2026-07
    94/100 stars

    Images



    Similar Products

    puromycin resistance sequence  (InvivoGen)
    99
    InvivoGen puromycin resistance sequence
    Puromycin Resistance Sequence, supplied by InvivoGen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/puromycin+sequence/10__1158_slash_2767___9764__crc___25___0119-70-17-29?v=InvivoGen
    Average 99 stars, based on 1 article reviews
    puromycin resistance sequence - by Bioz Stars, 2026-07
    99/100 stars
    		  Buy from Supplier
    puromycin resistance gene sequences  (TaKaRa)
    96
    TaKaRa puromycin resistance gene sequences
    Puromycin Resistance Gene Sequences, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/puromycin+sequence/pmc12450470-160-7-46?v=TaKaRa
    Average 96 stars, based on 1 article reviews
    puromycin resistance gene sequences - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    puromycin resistance gene 22 rd114a glycoprotein coding sequences  (Addgene inc)
    94
    Addgene inc puromycin resistance gene 22 rd114a glycoprotein coding sequences
    Puromycin Resistance Gene 22 Rd114a Glycoprotein Coding Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/puromycin+sequence/pm41481387-44-13-26?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    puromycin resistance gene 22 rd114a glycoprotein coding sequences - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    puromycin sequence  (Addgene inc)
    93
    Addgene inc puromycin sequence
    Puromycin Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/puromycin+sequence/pm41067888-237-29-31?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    puromycin sequence - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    sv40 early promotor puromycin resistance gene polyadenylation signal sequence  (TaKaRa)
    96
    TaKaRa sv40 early promotor puromycin resistance gene polyadenylation signal sequence
    Sv40 Early Promotor Puromycin Resistance Gene Polyadenylation Signal Sequence, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/puromycin+sequence/bio_rxiv__2025__04__29__650889-160-28-40?v=TaKaRa
    Average 96 stars, based on 1 article reviews
    sv40 early promotor puromycin resistance gene polyadenylation signal sequence - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier
    gv112 (hu6-mcs-cmv-puromycin, sifzd5 sequence: cggcatcttcacgctgctcta  (Genechem)
    90
    Genechem gv112 (hu6-mcs-cmv-puromycin, sifzd5 sequence: cggcatcttcacgctgctcta
    Gv112 (Hu6 Mcs Cmv Puromycin, Sifzd5 Sequence: Cggcatcttcacgctgctcta, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/puromycin+sequence/pm39834100-54-8-17?v=Genechem
    Average 90 stars, based on 1 article reviews
    gv112 (hu6-mcs-cmv-puromycin, sifzd5 sequence: cggcatcttcacgctgctcta - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    element sequence hu6mcs-ubiquitin-egfp-ires-puromycin  (Genechem)
    90
    Genechem element sequence hu6mcs-ubiquitin-egfp-ires-puromycin
    Element Sequence Hu6mcs Ubiquitin Egfp Ires Puromycin, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/puromycin+sequence/pm39798771-124-11-12?v=Genechem
    Average 90 stars, based on 1 article reviews
    element sequence hu6mcs-ubiquitin-egfp-ires-puromycin - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene  (VectorBuilder GmbH)
    90
    VectorBuilder GmbH lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene
    Lentivirus: Scrambled And Tβriii Targeted Lentiviral Shrna Expression Vectors With Predesigned Sequences Including Puromycin Resistant Gene, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/puromycin+sequence/pm39481440-347-17-21?v=VectorBuilder+GmbH
    Average 90 stars, based on 1 article reviews
    lentivirus: scrambled- and tβriii-targeted lentiviral shrna expression vectors with predesigned sequences including puromycin-resistant gene - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    sequence  (MedChemExpress)
    96
    MedChemExpress sequence
    Sequence, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/puromycin+sequence/pmc11515743-120-10-18?v=MedChemExpress
    Average 96 stars, based on 1 article reviews
    sequence - by Bioz Stars, 2026-07
    96/100 stars
    		  Buy from Supplier

    Image Search Results